View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_35 (Length: 408)
Name: NF17166_high_35
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 8e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 306 - 392
Target Start/End: Complemental strand, 6627282 - 6627196
Alignment:
| Q |
306 |
aagagcaatttatatgataaaaattaagttgcagggatatttgatacactattttatgtgcatgtactcaatggaaaactaacatgt |
392 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6627282 |
aagagcaatttacatgataaaaattaagttgcagggatatttgatacactattttatgtgcatgtactcaatggaaacctaacatgt |
6627196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 306 - 392
Target Start/End: Complemental strand, 6635081 - 6634995
Alignment:
| Q |
306 |
aagagcaatttatatgataaaaattaagttgcagggatatttgatacactattttatgtgcatgtactcaatggaaaactaacatgt |
392 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6635081 |
aagagcaatttacatgataaaaattaagttgcagggatatttgatacactattttatgtgcatgtactcaatggaaacctaacatgt |
6634995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University