View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_52 (Length: 331)
Name: NF17166_high_52
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 3 - 203
Target Start/End: Complemental strand, 33621656 - 33621445
Alignment:
| Q |
3 |
catgtccaagaatatacatcattatcggtatgaacaatgaaa-----------attactatcaaacaaaccatcataaacattcagtccctttgcaataa |
91 |
Q |
| |
|
|||| |||| || ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621656 |
catgaccaataaaatacatcattatcggtatgaacaatgaaacaatgaaaattactactatcaaacaaaccatcataaacattcagtccctttgcaataa |
33621557 |
T |
 |
| Q |
92 |
tttgcatccaatcactagcaagagagctaaaatcaacaccttaatttaatgtttttgagtatggaaacatacattatgtttgtatagtaaacttagaacc |
191 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33621556 |
tttgtatccaaccactagcaagagagctaaaatcaacaccttaatttaatgtttttgagtatggaaacatacattatgtttgtatagtaaacttagaacc |
33621457 |
T |
 |
| Q |
192 |
aatccagtaacc |
203 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33621456 |
aatccagtaacc |
33621445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 241 - 295
Target Start/End: Complemental strand, 33621407 - 33621352
Alignment:
| Q |
241 |
gagaacatacatgactatgtatgaacaaattagaaca-agttcagtccaaacactc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33621407 |
gagaacatacatgactatgtatgaacaaattagaacacagttcagtccaaacactc |
33621352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University