View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_65 (Length: 303)
Name: NF17166_high_65
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 18 - 290
Target Start/End: Complemental strand, 9127280 - 9126996
Alignment:
| Q |
18 |
ggttaattaggcaataatctgatagttatctat-tgagttacaatatgtaacttttaaaaggaacattcggtagttaaccac--gaggtagaaaattgga |
114 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
9127280 |
ggttaattgggcaataatccgatagttatctatctgagttacaatatgtaacttttaaaaggaacattcggtagttaactaccggaggtagaaaattgga |
9127181 |
T |
|
| Q |
115 |
annnnnnnn---------aatgaacatcctgtagaaaattggatttcttttttaaagaacattcttctttcttcactctttcgttctaagaaactcatag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9127180 |
ttttttttttttttttttaatgaacatcctgtagaaaattggattttttttttaatgaacattcttctttcttcactctttcgttccaagaaactcatag |
9127081 |
T |
|
| Q |
206 |
gagaaactttcttctaaaccctaacaacactttctttgtgacacaaacacaatgggacaaaccatttcttcttgtttggattctc |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9127080 |
gagaaactttcttctaaaccctaacaacactttctttgtgacacaaacacaatgggacaaaccatttcttcatgtttggattctc |
9126996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University