View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_69 (Length: 293)
Name: NF17166_high_69
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_69 |
 |  |
|
| [»] scaffold0041 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 133 - 277
Target Start/End: Original strand, 48668 - 48809
Alignment:
| Q |
133 |
gatttggaacactcaaagtagaggggctgatgagtgtgtcagaaacactgggaaactaagaagtgattatgccgcgtttatacttatacgggttactata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48668 |
gatttggaacactcaaagtagaggggctga---gtgtgtcagaaacactgggcaactaagaagtgattatgccgcgtttatacttatacgggttactata |
48764 |
T |
 |
| Q |
233 |
atactggacatagttttgtggtagctagcaagaacaccacaatat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48765 |
atactggacatagttttgtggtagctagcaagaacaccacaatat |
48809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 48547 - 48602
Alignment:
| Q |
12 |
atgaagactaaggtggaaccataaaacgtcgcatcttgttaggggaaagaggtaac |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48547 |
atgaggactaaggtggaaccataaaacgtcgcatcttgttaggggaaagaggtaac |
48602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 133 - 277
Target Start/End: Complemental strand, 40901350 - 40901209
Alignment:
| Q |
133 |
gatttggaacactcaaagtagaggggctgatgagtgtgtcagaaacactgggaaactaagaagtgattatgccgcgtttatacttatacgggttactata |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40901350 |
gatttggaacactcaaagtagaggggctga---gtgtgtcagaaacactgggcaactaagaagtgattatgccgcgtttatacttatacgggttactata |
40901254 |
T |
 |
| Q |
233 |
atactggacatagttttgtggtagctagcaagaacaccacaatat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40901253 |
atactggacatagttttgtggtagctagcaagaacaccacaatat |
40901209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 12 - 67
Target Start/End: Complemental strand, 40901471 - 40901416
Alignment:
| Q |
12 |
atgaagactaaggtggaaccataaaacgtcgcatcttgttaggggaaagaggtaac |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40901471 |
atgaggactaaggtggaaccataaaacgtcgcatcttgttaggggaaagaggtaac |
40901416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University