View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_82 (Length: 273)
Name: NF17166_high_82
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_82 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 35204887 - 35204630
Alignment:
| Q |
1 |
tcttttattttcttaattgttaggccttgtgcagcctcggagtcaaagaagtaaacgactttaaggtagtgaagtttcatggccaggtccaaaccgttcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
35204887 |
tcttttattttcttaattgttaggccttgtgcagcctcggagtcaaagaagtaaacgactttaaggtagtgaagtttcatggtcagatccaaaccgttcg |
35204788 |
T |
 |
| Q |
101 |
gattgtgaaaaacatccgacccggtggcatgacctggcccaactgaggatactctcaaatcatatactaaactctctttctcttcttgtgggaaaaccat |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35204787 |
gataatgaaaaacatccgacccggtggcatgacctggcccaactgaggatactctcaaatcatacactaagctctctttctcttcttgtgggaaaaccat |
35204688 |
T |
 |
| Q |
201 |
attggtggtttaagcttataa------aagtttaatttgttgaaagatacaagaggct |
252 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35204687 |
attggtggtttaagcttataagaaagcaagtttaatttgttgaaagatacaagaggct |
35204630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University