View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_83 (Length: 272)
Name: NF17166_high_83
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 47709929 - 47709709
Alignment:
| Q |
7 |
ggagcagagaaaaaataaagtatatttcacttcagtcaaggttggcatcagcttggaactcactataaactcattttaccatggcttttttaagttccaa |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47709929 |
ggagaagagaaaaaataaagtatatttcacttcactcaaggttggcatcagcttggaactcactataaactcattttaccatggcttttttaagttccaa |
47709830 |
T |
 |
| Q |
107 |
catgttgattataaaagtaagctagggatagatttggagttgaaagtatgtataaactcannnnnnnatgtttaggattgagggcaaaaataaacatgta |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47709829 |
aatgttgattataaaagttagctagggatagatttggagttgaaagtatgtataaactca-ttttttatgtttaggattgagggcaaaaataaacatgta |
47709731 |
T |
 |
| Q |
207 |
aaaggaatttttcttcattgtt |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47709730 |
aaaggaatttttcttcattgtt |
47709709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University