View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_91 (Length: 251)
Name: NF17166_high_91
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_91 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 19 - 210
Target Start/End: Original strand, 55061953 - 55062143
Alignment:
| Q |
19 |
atattttaagctcagatctaattgtttatattaatttttctatatctgnnnnnnnnnnncttcttctttttactgctttcatgattggcatggttcgatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55061953 |
atattttaagctcagatctaattgtttatatttatttttctatatctgtttttttctt-cttcttctttttgctgctttcatgattggcatggttcgatc |
55062051 |
T |
 |
| Q |
119 |
aataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttgtttg |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55062052 |
aataaatcatagcggggctgtaattttgcgcttttatcggttttcagtgcatgtgcaatttagtttgatatctatccctcatgcgttgtttg |
55062143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 210
Target Start/End: Original strand, 40932150 - 40932253
Alignment:
| Q |
107 |
catggttcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctcatgcgttg |
206 |
Q |
| |
|
||||||||||||||| | ||| ||||| ||||| ||||||| |||||||| ||||| |||||||||||||||||||||| ||||| ||||||| ||| |
|
|
| T |
40932150 |
catggttcgatcaatgagtcacagcagtgctgttattttgcacttttatccattttcgatgcatgtgcaattttgtttgatttctattcctcatgtgttc |
40932249 |
T |
 |
| Q |
207 |
tttg |
210 |
Q |
| |
|
|||| |
|
|
| T |
40932250 |
tttg |
40932253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 108 - 199
Target Start/End: Original strand, 40940181 - 40940270
Alignment:
| Q |
108 |
atggttcgatcaataaatcatagcagggctgtaattttgcgcttttatcggttttcagtgcatgtgcaattttgtttgatatctatccctca |
199 |
Q |
| |
|
||||||| |||||||||||||||| ||||||| |||||||||||||||| ||||| || ||||||| ||||| ||||| ||||||||||| |
|
|
| T |
40940181 |
atggttcaatcaataaatcatagcggggctgtcattttgcgcttttatcagtttttgatg-atgtgcacttttg-ttgatttctatccctca |
40940270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University