View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_high_98 (Length: 244)
Name: NF17166_high_98
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_high_98 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 31804257 - 31804477
Alignment:
| Q |
7 |
tagattattctagttgcttcaaatcacgttgtatgcattctaggaaagaattgatataatcttgaattgggtcagtctatttgagtaattataagggttt |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31804257 |
tagattattatagttgcttcaaatcacgttgtatgcattctaggaaagaattgatataatcttgaattgggtcagtctatttgagtaattataagggttt |
31804356 |
T |
 |
| Q |
107 |
caataagttgagctttacctttattcnnnnnnnntaa--taagttgagctttacctgaactaatttactaagctcactaaatatttggtcaagctcgttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||| || || |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31804357 |
caataagttgagctttacctttattcaaaaaaataaaataaaattgagctttacctgaactaa-ttactaagctcactaaatatttggtcaagctcgttt |
31804455 |
T |
 |
| Q |
205 |
ggtgattaaatgagtcaagcct |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31804456 |
ggtgattaaatgagtcaagcct |
31804477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University