View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_100 (Length: 250)
Name: NF17166_low_100
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 9 - 227
Target Start/End: Complemental strand, 56030193 - 56029973
Alignment:
| Q |
9 |
caacaatatgcaatgacaattgctctttaagcacctcaaaattgctcatcttattgaaaatagttggtcaaaagttacgcctcgatcaaattttacacac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
56030193 |
caacaatatgcaatgacaattgctctttaagcacctcaaaattgctcatcttattgaaaatagttggtcaaaagttacgactcgatcaaattttacatac |
56030094 |
T |
 |
| Q |
109 |
aaaaatagttggtcgggagttacgacccgattgaaagagaatttgaattgcctaattagcaattgtcatacgtaatagatatgattcatgtattaaatgt |
208 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56030093 |
aaaaatagttggttgggagttacgacccgattgaaagagaatttgaagtgcctaattagcaattgtcatacgtaatagatatgattcatgtattaaatgt |
56029994 |
T |
 |
| Q |
209 |
c--ttaagtttttggttgaaa |
227 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
56029993 |
cttttaagtttttggttgaaa |
56029973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 105
Target Start/End: Complemental strand, 6361336 - 6361271
Alignment:
| Q |
40 |
cacctcaaaattgctcatcttattgaaaatagttggtcaaaagttacgcctcgatcaaattttaca |
105 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| ||| |||||||||| |||||| ||||||||| |
|
|
| T |
6361336 |
cacctcaaaattactcattgtattgaaaatagtaggtaaaaagttacgattcgatcgaattttaca |
6361271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University