View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_108 (Length: 240)
Name: NF17166_low_108
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_108 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 19258085 - 19258317
Alignment:
| Q |
1 |
aataaagtaaagtctttgatattgattcgaatccaatttgtgagatgacaacgatctttagctgatcatgcccataataaaggttgttctaactgaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| | | |||||| |
|
|
| T |
19258085 |
aataaagtaaagtctttgatattggttcgaatccaattcgtgagatgacaatgatctttagctgatcatgcccataataaaggttgttccagccgaaaga |
19258184 |
T |
 |
| Q |
101 |
tgatcccagatttgtctgacctaccgttaactttgcagtactcccacccaggtatggacaggtggcatagcgcaatcctcaccgatgtggtgtctaatca |
200 |
Q |
| |
|
||||| | ||| ||||||||||||||||| ||||||||||||||||||||| || ||||| |||||||| ||||||||||||||||||||||| | ||| |
|
|
| T |
19258185 |
tgatctctgatctgtctgacctaccgttagctttgcagtactcccacccagttaacgacagatggcatagtgcaatcctcaccgatgtggtgtccagtca |
19258284 |
T |
 |
| Q |
201 |
caaccctaattttccactttctttcctttgctt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
19258285 |
caaccctaattttccactttctttccttggctt |
19258317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 156 - 228
Target Start/End: Original strand, 15639960 - 15640032
Alignment:
| Q |
156 |
ggacaggtggcatagcgcaatcctcaccgatgtggtgtctaatcacaaccctaattttccactttctttcctt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
15639960 |
ggacaggtggcatagcgcaatcctcaccgatgtggtgtccagtcacaaccctaattttccactttcattcctt |
15640032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University