View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_112 (Length: 238)
Name: NF17166_low_112
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_112 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 56029583 - 56029795
Alignment:
| Q |
18 |
tttattagatctcttgttcaaatcttccattaatgaaaaagaaatccactttatcctttttgaaatcatagggctgtctctattacaaaattcttttaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56029583 |
tttattagatctcttgttcaaatcttccattaatgaaaaagaaatccactttatcctttttgaaatcatagggctgtctctattacaaaattcttttaaa |
56029682 |
T |
 |
| Q |
118 |
tattagagaaacgaatcgcatatatgggaaaggttatacacttatacttatacatctttgttagcattggggtaattcaagatactctgtccatcatatc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56029683 |
tattagagaaacgaatcgcatatatgggaaagg--------ttatacttatacatctttgttagcattggggtaattcaagatactctgtccatcatatc |
56029774 |
T |
 |
| Q |
218 |
atgtttatgtatttcccatgt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
56029775 |
atgtttatgtatttcccatgt |
56029795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University