View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_116 (Length: 231)
Name: NF17166_low_116
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_116 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Original strand, 13972584 - 13972781
Alignment:
| Q |
19 |
cccccttggcaaaggcaactgatattcaaagaatgctctcgagaaatgtctctgtattttcctcttcagcagcactctttgataaattggagaagaagca |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13972584 |
cccccttggcaaaggcaaccgatattcaaagaatgctctcgagaaatgtctctgtattttcctcttcagcagcactctttgataaattggagaagaagca |
13972683 |
T |
 |
| Q |
119 |
actttccatagacgaagatattcctttagatggaaagagcaatgatagctccgttcttaatagattgaagtcaagttatagtcggaccgctagtataa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13972684 |
actttccatagacgaagatattcctttagatggaaagagcaatgatagctccgttcttaatagattgaagtcaagttatagtcggaccgctagtataa |
13972781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University