View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_117 (Length: 231)
Name: NF17166_low_117
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_117 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 38700122 - 38699898
Alignment:
| Q |
10 |
actgctcttcatatgtttgtttcataatgcttcccctctatactgacttcttaataatcgtggtttttaatggttggtgagctttagagattagttttcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38700122 |
actgctcttcatatgtttgtttcataatgcttcctctctatactgactgcttaataaacggggtttttaatggttggtgagctttagagattagttttca |
38700023 |
T |
 |
| Q |
110 |
ttagaataaattgattatggtttct-ttttaatgtttttaaatct----cttcattaccgtttctttaacatgatcatttcccatgatatgtagatagaa |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||| ||||||||| || |
|
|
| T |
38700022 |
aaagaataaattgattatggtttcttttttaatgtttttaaatctcgtacgtcattaccgtttctttaacatgatcttttcccatg--atgtagataaaa |
38699925 |
T |
 |
| Q |
205 |
atccactcaatgttgatgctttttaac |
231 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38699924 |
atccactcaatgttgatgctttttaac |
38699898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University