View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17166_low_117 (Length: 231)

Name: NF17166_low_117
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17166_low_117
NF17166_low_117
[»] chr7 (1 HSPs)
chr7 (10-231)||(38699898-38700122)


Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 38700122 - 38699898
Alignment:
10 actgctcttcatatgtttgtttcataatgcttcccctctatactgacttcttaataatcgtggtttttaatggttggtgagctttagagattagttttcc 109  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||     
38700122 actgctcttcatatgtttgtttcataatgcttcctctctatactgactgcttaataaacggggtttttaatggttggtgagctttagagattagttttca 38700023  T
110 ttagaataaattgattatggtttct-ttttaatgtttttaaatct----cttcattaccgtttctttaacatgatcatttcccatgatatgtagatagaa 204  Q
      ||||||||||||||||||||||| |||||||||||||||||||    | ||||||||||||||||||||||||| |||||||||  ||||||||| ||    
38700022 aaagaataaattgattatggtttcttttttaatgtttttaaatctcgtacgtcattaccgtttctttaacatgatcttttcccatg--atgtagataaaa 38699925  T
205 atccactcaatgttgatgctttttaac 231  Q
    |||||||||||||||||||||||||||    
38699924 atccactcaatgttgatgctttttaac 38699898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University