View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_120 (Length: 223)
Name: NF17166_low_120
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_120 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 27778374 - 27778565
Alignment:
| Q |
18 |
atattgaacctaataggtcatatttagaatatcgtgtggatgatttttcattttggcttcgtagaagggttagaagttcacataaatgggatggaataaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27778374 |
atattgaacctaataggtcatatttagaatatcgagtggatgatttttcattttggcttcgtagaagggttagaagttcacataaatgggatggaataaa |
27778473 |
T |
 |
| Q |
118 |
gagttgtcttagttcatcaaatatgtgtgctgagttgaatcaaagttatagaattgctcaagannnnnnnaatgctcacctatcacctttgc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27778474 |
gagttgtcttagttcatcaaatatgtgtgctgagttgaatcaaagttatagaattgctcaagatttctttaatgctcacctatcacctttgc |
27778565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University