View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17166_low_123 (Length: 214)

Name: NF17166_low_123
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17166_low_123
NF17166_low_123
[»] chr7 (1 HSPs)
chr7 (16-196)||(31478943-31479124)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 31478943 - 31479124
Alignment:
16 aatatgtatgtagagtagcccataacatcatagtctattctagttggtttatagtctattcatagaaatgtcatacaaaaccatatgagtggcaaacaaa 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31478943 aatatgtatgtagagtagcccataacatcatagtctattctagttggtttatagtctattcatagaaatgtcatacaaaaccatatgagtggcaaacaaa 31479042  T
116 accagcctaagctagataacccatt-nnnnnnngtcaaagtaattaagaaatgccatatgatagaaatgccacttatagata 196  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||    
31479043 accagcctaagctagataacccattaaaaaaaagtcaaagtaattaagaaatgccatatgatagaaatgccacttatagata 31479124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University