View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_49 (Length: 343)
Name: NF17166_low_49
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 8 - 141
Target Start/End: Original strand, 31705131 - 31705264
Alignment:
| Q |
8 |
gagatgaatagaaaagatggagtttcatagacttttaa-ttttttcttgaaaatttggaatttgatatagtgagttaactccaaattcatatataaaaat |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31705131 |
gagatgaatagaaaagatgaagtttcatagacttttaatttttttcttg-aaatttggaatttgatatagtgagttaactccaaattcatatataaaaac |
31705229 |
T |
 |
| Q |
107 |
gtgaaattgaatgattttatgaatgaaaactcgat |
141 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |
|
|
| T |
31705230 |
gtgaatttgaatgattttatgaattaaaactcgat |
31705264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 82 - 179
Target Start/End: Original strand, 31705040 - 31705137
Alignment:
| Q |
82 |
taactccaaattcatatataaaaatgtgaaattgaatgattttatgaatgaaaactcgatcataacaattttattatagatataaatattggagatga |
179 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| | |||||||| ||| |||||||||| |||||||||||| || ||||| || ||||||||||| |
|
|
| T |
31705040 |
taactccaaattcatacctaaaaaggtggaattggacgattttatcaattaaaactcgattttaacaattttatcatggatatgaagattggagatga |
31705137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 291 - 326
Target Start/End: Original strand, 31705268 - 31705303
Alignment:
| Q |
291 |
tttttaaagaagaatggtaaaaatcgtatgcacttt |
326 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31705268 |
tttttaaagaagaatggtaaaaatcgtatgcacttt |
31705303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University