View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_56 (Length: 330)
Name: NF17166_low_56
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 64 - 312
Target Start/End: Original strand, 40375179 - 40375432
Alignment:
| Q |
64 |
cccaaataaagttaaggcagttcataaagctgaaagactcagagcatatacaaaccctcttggttaaaagtttttcttatttacga-tttgttgcaaaat |
162 |
Q |
| |
|
||||| |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
40375179 |
cccaattaaaattaaggcagttcgtaacgctgaaagactcagagcatatacaaaccctcttggttaaaagttttttttatttatgaatttgttgcaaaat |
40375278 |
T |
 |
| Q |
163 |
agaactcgttatatttagaaatgagttttattttaaaattagg----ttgctagaccctttatttgtgtggaaatgatctcaaacatttaagaaggccaa |
258 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40375279 |
agaactcattatatttagaaatgagttttattttaaaattaggtaggttgctagaccctttatttgtgtggaaatgatctcaaacatttaggaaggccaa |
40375378 |
T |
 |
| Q |
259 |
atcataattgtttcatgttgactgatggtgatacttttgtgaagcaccttgtta |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40375379 |
atcataattgtttcatgttgactgatggtgatacttttgtgaagcaccttgtta |
40375432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 230 - 275
Target Start/End: Complemental strand, 654118 - 654073
Alignment:
| Q |
230 |
aaatgatctcaaacatttaagaaggccaaatcataattgtttcatg |
275 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
654118 |
aaataatctcaaacatttaagaagaccaaatcataatagtttcatg |
654073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University