View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_58 (Length: 328)
Name: NF17166_low_58
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 35214986 - 35214777
Alignment:
| Q |
14 |
agacaaatacttaaatatttttgatattaaccctccaattttcaagagaaaaggggtcatagtaatccagaatttgctggagctcttaatgattgattca |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35214986 |
agacaagtacttaaatatttttgatattaaccctccaattttcaaaagaaaaggg-tcatagtaatccagaatttgctggagctcttaacgattgattca |
35214888 |
T |
 |
| Q |
114 |
gctaaa-cttgaatttatattctagtactaaatagttaatcatttaagtcaaaccacttagataagttttatatacttcatcatgatcttgctttcattt |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35214887 |
gctaaaacttgaatttatattctagtactaaatagttaatcatttaagtcaaaccacttagataagttttatatacttcatcatgatcttgctttcattt |
35214788 |
T |
 |
| Q |
213 |
tttaaattcca |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
35214787 |
tttaaattcca |
35214777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 267 - 312
Target Start/End: Complemental strand, 35214782 - 35214737
Alignment:
| Q |
267 |
attccacacatctcaattttcagccgactatttataattcatatat |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35214782 |
attccacacatctcaattttcagccgactatttataattcatatat |
35214737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University