View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_60 (Length: 323)
Name: NF17166_low_60
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 44 - 303
Target Start/End: Complemental strand, 26063852 - 26063593
Alignment:
| Q |
44 |
ttgtttatatgaactctctaagcaactctagccgacttaccctttccttcccccacataatttaaaccatttatccaatttgtagatgatctctttggtg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26063852 |
ttgtttatatgaactctctaagcaactctagccgacttaccctctccttcccccacatcatttaaaccatttatccaatttgtagatgatctctttggtg |
26063753 |
T |
|
| Q |
144 |
gtgccatgagtggcaaaaggccctttgtaccatccagttttcggctctctcgaagtctcccatgacgttagcttggaggttctagtgtcgccgccgccct |
243 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26063752 |
gtgccatgagtggcaaaaggccctctgtaccacccagttttcggttctctcaaagtctcccacgacgttagcttggaggttctagtgtcgccgccgccct |
26063653 |
T |
|
| Q |
244 |
tggtggtttttcgaagccctggtttgtggtttgttggatctatctgccctcttggtttga |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26063652 |
tggtggtttttcgaagccctggtttgtggtttgttggatctatctgccctcttggtttga |
26063593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University