View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_63 (Length: 316)
Name: NF17166_low_63
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_63 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 151
Target Start/End: Complemental strand, 8003237 - 8003104
Alignment:
| Q |
18 |
aaaacctccaaacatatcaaatcaatttaaaatcttcaaaatcacttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003237 |
aaaacctccaaacatatcaaatcaatttaaaatcttcaaaatcatttttgaaaataggatattgagaggctattagtgatggctatgtgctgctttgaca |
8003138 |
T |
 |
| Q |
118 |
cccatgtgaagctgaattttcatgaacccccatc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8003137 |
cccatgtgaagctgaattttcatgaacccccatc |
8003104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 198 - 306
Target Start/End: Complemental strand, 8003057 - 8002949
Alignment:
| Q |
198 |
tgatacttgagaaggttggattttgacatgacatattgatatgcacatataattgttgttaaaagcatgcaacatgtcctataaagctcttttggatgca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8003057 |
tgatacttgagaaggttggattttgacatgacatgttgatatgcacatataattgttgttaaaagcatgcaacatgtcctataaagctcttttggatgca |
8002958 |
T |
 |
| Q |
298 |
gtacctatg |
306 |
Q |
| |
|
||||||||| |
|
|
| T |
8002957 |
gtacctatg |
8002949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University