View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_70 (Length: 295)
Name: NF17166_low_70
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_70 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 279
Target Start/End: Complemental strand, 28600510 - 28600241
Alignment:
| Q |
10 |
aagaatattaaatatgatccaaattcatgcatttatacatatttacatggctctaaagtatagctgcagttatgctgcaaaccatggactaaaatgcaaa |
109 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600510 |
aagaaaattaaatatgatcgaaattcatgcatttatacatatttacatggctctaaagtatagctgcagttatgctgcaaaccatggactaaaatgcaaa |
28600411 |
T |
|
| Q |
110 |
cagactcaaccgatgcaaccgtgattgcagttgattagacttctaaaacagttatattgtggccgcaatcatagatgaacttttatcttacagttaaatg |
209 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600410 |
caaactcaaccgatgcaaccgtgattgcagttgcttagacttctaaaacagttatattgtggccgcaatcatagatgaacttttatcttacagttaaatg |
28600311 |
T |
|
| Q |
210 |
caggcaaatgcgaacaatgcaaccataattatagttgctgatgcagctaaaagccaaaaactgttatatt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28600310 |
caggcaaatgcgaacaatgcaaccataattatagttgctgatgcagctaaaagccaaaaactgttatatt |
28600241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University