View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_76 (Length: 289)
Name: NF17166_low_76
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 1028304 - 1028403
Alignment:
| Q |
18 |
cttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcgtaaatacaaaagaaaattagttgacttttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028304 |
cttggaagcaaaagctcatggtcatctttgttctcatgagttcaacgattacttcatcagtgctggctcgtaaatacaaaagaaaattagttgacttttg |
1028403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 115 - 194
Target Start/End: Original strand, 1033609 - 1033688
Alignment:
| Q |
115 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaaggtctgtgtagaagacgttcattggaa |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
1033609 |
ttggtgattcctggcagttgctgcttccaaattctgcttcatttctgtgggaagatcttggtagaagacgttcattggaa |
1033688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 117 - 246
Target Start/End: Complemental strand, 50832502 - 50832377
Alignment:
| Q |
117 |
ggtgattgctggcagttgctgcttccaaattc---tgcttcatttctatgggaaggtctgtgtagaagacgttcattggaagttggaactcttggtagat |
213 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||||||||||| ||||||| ||| |||| ||||||| ||||||| |||||||||||| |
|
|
| T |
50832502 |
ggtgattcctggcagttgctgcttccgaattccgctgcttcatttctgtgggaagatcttggtaggagacgtttattggaa-------ctcttggtagat |
50832410 |
T |
|
| Q |
214 |
ggaactgacccaatgaaatccctgaagtacgat |
246 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
50832409 |
ggaactgacccaatgaaatcgctgaagtacgat |
50832377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 115 - 193
Target Start/End: Original strand, 4516149 - 4516227
Alignment:
| Q |
115 |
ttggtgattgctggcagttgctgcttccaaattctgcttcatttctatgggaaggtctgtgtagaagacgttcattgga |
193 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
4516149 |
ttggtgattcctggcagctgctgcttccaaattctgcttcatttctgtgggaagatcttggtagaagacgttcattgga |
4516227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University