View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_77 (Length: 287)
Name: NF17166_low_77
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 2244218 - 2244473
Alignment:
| Q |
16 |
agagagaggattcttttggcttaatcttttgattctaggtagcattatgttactaaattactaatttttattttcatttgagaattgctaggtttcattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244218 |
agagagaggattcttttggcttaatcttttgattctaggtagcattatgttactaaattactaatttttattttcatttgagaattgctaggtttcattt |
2244317 |
T |
 |
| Q |
116 |
actgactgcacaatccttcacgctcaattcctagctgtggagaacgccgagttgcactgattcactcgacggtaaagggaaagctgcggagttgatttgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2244318 |
actgactgcacaatccttcacgctcaattcctagctgtggagaacgccgagttgcactgattcactcgacggtaaagggaaagctacggagttgatttgt |
2244417 |
T |
 |
| Q |
216 |
tttttcaactcagtggtgagtgacaaatttcaggttctgaattcttttctcaatat |
271 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2244418 |
tttttcaactcagtagtgagtgacaaatttcaggttctgaattcttttctcaatat |
2244473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University