View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_87 (Length: 269)
Name: NF17166_low_87
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_87 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 143 - 239
Target Start/End: Complemental strand, 11666439 - 11666343
Alignment:
| Q |
143 |
agaatttctagaacattttttgtgtttttatgaacgtgtgataaatannnnnnnnaagaaatcaaaatgatattaataacctcaggactatcttcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11666439 |
agaatttctagaacattttttgtgtttttatgaacgtgtgataaatattttttttaagaaattaaaatgatattaataacctcaggactatcttcat |
11666343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 198 - 239
Target Start/End: Complemental strand, 1711016 - 1710975
Alignment:
| Q |
198 |
aagaaatcaaaatgatattaataacctcaggactatcttcat |
239 |
Q |
| |
|
|||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
1711016 |
aagaaatcaaaatgatattattaaccacaagactatcttcat |
1710975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University