View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17166_low_95 (Length: 251)
Name: NF17166_low_95
Description: NF17166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17166_low_95 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 138 - 251
Target Start/End: Complemental strand, 55062478 - 55062365
Alignment:
| Q |
138 |
gtgaggcttgtcattttgtccttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaaa |
237 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55062478 |
gtgaggcttgtcattttgtacttttatcaacttttgatttattgatatagccattctaagacacacccacattaattagaatttcatttattttcttaaa |
55062379 |
T |
 |
| Q |
238 |
gggtaaagatttta |
251 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
55062378 |
gggtaaagatttta |
55062365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 69 - 111
Target Start/End: Complemental strand, 55062553 - 55062511
Alignment:
| Q |
69 |
tcagaattcaaatgtttatataaccgcaaaataacaaactcta |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
55062553 |
tcagaattcaaatgtttataaaaccgcaaaataacaaactcta |
55062511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 47
Target Start/End: Complemental strand, 55062606 - 55062575
Alignment:
| Q |
16 |
atgacacatgtatcaaacaaataaaggagacg |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55062606 |
atgacacatgtatcaaacaaataaaggagacg |
55062575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University