View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_28 (Length: 421)
Name: NF17168_high_28
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 6 - 323
Target Start/End: Original strand, 27843183 - 27843500
Alignment:
| Q |
6 |
gtcgaagaatatgaaattgacgagagtaataacaactgacttatcataagccgaatagggttataacggctagactcctacttgacggcgcaatgatgac |
105 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27843183 |
gtcgaagtaaatgaaattgacgagagtaataacaactgacttatcataagccgaatagggttataacggctagactcccacttgacggcgcaatgatgac |
27843282 |
T |
|
| Q |
106 |
tttgttcatgcacaaacacaatttattacgtcacataatttcatttctaagagatcaaccgatatgacatatgacatttgcttacacctaaaaataattg |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843283 |
tttgttcatgcacaaacacaatttattgcgtcacataatttcatttctaagagatcaaccgatatgacatatgacatttgcttacacctaaaaataattg |
27843382 |
T |
|
| Q |
206 |
tcctgttaattgaatttgacaagtagacgattacaacaataaaacgaagaagcccttcaaccgagtgaaggataggcgatgcaagaacatccgagcgagg |
305 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843383 |
tcctgttaattgaatttgacaagtaggcgattacaacaataaaacgaagaagcccttcaactgagtgaaggataggcgatgcaagaacatccgagcgagg |
27843482 |
T |
|
| Q |
306 |
gagctaattctttctcaa |
323 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27843483 |
gagctaattctttctcaa |
27843500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 344 - 403
Target Start/End: Original strand, 27843564 - 27843623
Alignment:
| Q |
344 |
tggataatggcgcattacccacaatttgctactctcgacgccaaaccgctcctaggaatg |
403 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27843564 |
tggataatggcgcattacccacaattttctactctcgacgccaaaccgctcctaggaatg |
27843623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 13759976 - 13760016
Alignment:
| Q |
283 |
gatgcaagaacatccgagcgagggagctaattctttctcaa |
323 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
13759976 |
gatgctagaacatccgagcgagggagataattatttctcaa |
13760016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University