View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_42 (Length: 366)
Name: NF17168_high_42
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_42 |
 | |
|
| [»] scaffold0831 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 14 - 84
Target Start/End: Complemental strand, 3818438 - 3818367
Alignment:
| Q |
14 |
tacttcattgacaagccaaaaaatataaa-tgaggaaggggatgaaggccgagtcagtgaaattgctaacca |
84 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3818438 |
tacttcattgacaagccaaaaaatataaaatgaggaaggggatgaaggccgagtcagtgaaattgctaacca |
3818367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 349
Target Start/End: Complemental strand, 3818166 - 3818093
Alignment:
| Q |
276 |
aggtagtaattctctaattgcaatttagatgccatacctgtttcnnnnnnnaaacgtcgtctttttaattcttt |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
3818166 |
aggtagtaattctctaattgcaatttagataccatacctgtttctttttttaaacgtcgtctttctaattcttt |
3818093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0831 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0831
Description:
Target: scaffold0831; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 101 - 137
Target Start/End: Complemental strand, 3070 - 3034
Alignment:
| Q |
101 |
tttttactcccttcgttcctctttaattgtcactttt |
137 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
3070 |
tttttactccctccgttcctttttaattgtcactttt |
3034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 95 - 139
Target Start/End: Original strand, 3720650 - 3720694
Alignment:
| Q |
95 |
agttgttttttactcccttcgttcctctttaattgtcacttttga |
139 |
Q |
| |
|
|||| ||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
3720650 |
agttatttcttactccctccgttcctttttaattgtcacttttga |
3720694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 104 - 140
Target Start/End: Complemental strand, 2642960 - 2642924
Alignment:
| Q |
104 |
ttactcccttcgttcctctttaattgtcacttttgag |
140 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
2642960 |
ttactccctccgttcctttttaattgtcacttttgag |
2642924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University