View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_49 (Length: 330)
Name: NF17168_high_49
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 49064420 - 49064730
Alignment:
| Q |
1 |
ttcatttgaaagaaaaaggtagtataagatgcaaagggaaacgtcaacaacgaatggggacatggtgtccttgctgatagacgtttaagtacataagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49064420 |
ttcatttgaaagaaaaaggtagtataagatgcaaagggaaacgtcaacaacgaatggggacatggtgtccttgctgatagacgtttaagtaaataagaag |
49064519 |
T |
|
| Q |
101 |
tttgtttggtattggtaacattcatgtacatgacaaaccataatgtttggctctgtctccnnnnnnnatcatgcgtgattgcatcacttatttttggtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49064520 |
tttgtttggtattggtaacattcatgtacatgacaaaccataatgtttggctctgtctcctttttttatcatgcgtgattgcatcacttatttttggtcc |
49064619 |
T |
|
| Q |
201 |
tcttgatacgcccaaaggccaacaccaaacgataccttattgctcaattccaagactataatgcctcaaatacaatatatgtctgtctctatacgagcac |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49064620 |
tcttgatacgcccaaaggccaaaaccaaacgataccttattgctcaattccaagactataatgcctcaaatacaatatatgtctgtctctatacgagcac |
49064719 |
T |
|
| Q |
301 |
ataccacatgc |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
49064720 |
ataccacatgc |
49064730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University