View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_69 (Length: 263)
Name: NF17168_high_69
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_69 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 34466150 - 34465903
Alignment:
| Q |
18 |
accacctgtaatcaaagtcagttggcactgaggnnnnnnnn--taccacccacaaccatgtgagaattgtggcgtttgcttagagcataatctaaattct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34466150 |
accacctgtaatcaaagtcagttggcactgaggaaaaaaaaaataccacccacaaccatgtgagaattgtggcgtttgcttagagcataatctaaattct |
34466051 |
T |
|
| Q |
116 |
taaacaaatagagtattcagcatatcaacgtccaaaatgtcattttcgttggtttggaaaataattccaacgaaaactaactattgttcgcctcgcccat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34466050 |
taaacaaatagagtattcagcatatcaacgtccaaaatgtcattttcgttggtttggaaaataattccaatgaaaactaactattgttcgcctcgcccat |
34465951 |
T |
|
| Q |
216 |
gaacgaactgtttgtgttaaccatatgagagttctacatgcaaatgcc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34465950 |
gaacgaactgtttgtgttaaccatatgagagttctacatgcaaatgcc |
34465903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 65 - 147
Target Start/End: Complemental strand, 34464402 - 34464320
Alignment:
| Q |
65 |
ccacaaccatgtgagaattgtggcgtttgcttagagcataatctaaattcttaaacaaatagagtattcagcatatcaacgtc |
147 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| || || ||||||||||| || ||||||| |||||| ||| |||||||| |
|
|
| T |
34464402 |
ccacaaccatgtgagaatagtggtgtttgcttggaacaaaatctaaattccaaaccaaataggttattcaacatctcaacgtc |
34464320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University