View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_76 (Length: 249)
Name: NF17168_high_76
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_76 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 6886694 - 6886933
Alignment:
| Q |
10 |
aagaatatggctcgtattcataaatcaaaatgcaagaaatataaacatgaacttaccaaaaacattgatcccaagatgattatacacaggggagaaaaaa |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6886694 |
aagaaaatggctcgtattcataaatcaaaatgcaagaaatatagacatgaacttaccaaaaacattgatcccaagatgattatacacaggggagaaaaaa |
6886793 |
T |
 |
| Q |
110 |
ccatcaacaaaccgaacaaatccccatgtgatatagaatgttattgcaatgggaagaaggatcacactgcatattacgttacattgttaatatttccacc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6886794 |
ccatcaacaaaccgaacaaatccccatgtgatatagaatgttattgcaatgggaagaaggatcacactgcatattacgtcacattgttaatatttccacc |
6886893 |
T |
 |
| Q |
210 |
aaagaatggtaacaatcagaacaatcttcatgagtgttgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6886894 |
aaagaatggtaacaatcagaacaatcttcatgagtgttgc |
6886933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University