View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_high_80 (Length: 240)
Name: NF17168_high_80
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_high_80 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 45289378 - 45289203
Alignment:
| Q |
18 |
gccatatcaaacacctcaccaccaaaaagtgatgattggggtctaattttgattattagggatgtaattggtgctttctattccttattgaggattactt |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45289378 |
gccatatcaaacacctcaccaccaaaa-gtgatggttggggtctaattttgtttattagggatgtaattggtgctttctattccttattgaggcttactt |
45289280 |
T |
|
| Q |
118 |
acaaagattatgtagnnnnnnngcacatcgttacactaattgtgcttagtgtcttttaatccatattttaccttttc |
194 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45289279 |
acaaagattatgtagtttttttgcacatcgttgcactaattgtgcttagtgtcttttaatccatattttaccttttc |
45289203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University