View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_13 (Length: 517)
Name: NF17168_low_13
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 110 - 356
Target Start/End: Complemental strand, 28053921 - 28053675
Alignment:
| Q |
110 |
tattctacatgaagacgacgaggaggatcgtgagcttctgcttccggattcggcgaaggtgtcttcgccggataaggatgttgttgatgttgatagaagg |
209 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28053921 |
tattctacatgaagaggacgaggaggatcgtgagcttctgcttccggattcagagaaggtgtcttcgcctgataaggatgttgttgatgttgatagaagg |
28053822 |
T |
|
| Q |
210 |
tttgaaagggaggcttcgttatctagattgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053821 |
tttgaaagggaggcttcgttatctagattgtcgagtggaagcagttacgcgacgagtttgtttgcttcagatgttaccgttactgctacattctcaagtg |
28053722 |
T |
|
| Q |
310 |
atgatattacaaaagaagatacgtcgtcgtttcgagtttctactaat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053721 |
atgatattacaaaagaagatacgtcgtcgtttcgagtttctactaat |
28053675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 432 - 507
Target Start/End: Complemental strand, 28053599 - 28053524
Alignment:
| Q |
432 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053599 |
tacgctaaggagtgtaaagaaagctatgaactacaaacagcgttggcgaagaggctttctttcttatcaacctttg |
28053524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University