View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_63 (Length: 299)
Name: NF17168_low_63
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 5355750 - 5355470
Alignment:
| Q |
1 |
gcattcgaatatataatgctgatgttcaaatgtaaacgtgcgtgtaaatgattgtgccttaaaatcaataatttggagtttatggtggttgtgattcgaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
5355750 |
gcatccgaatatataatgctgatgtccaaatgtaaacgtatgtgtaaatgattgtgccttaaaatcaacaatttggagtttatggtggttgtgatttgaa |
5355651 |
T |
 |
| Q |
101 |
ttaaaaccgagagtgattccaatcatgacaaatgttttgtcattctgattttctgtttatgtgaatatgattcaaatcacatgtgcttttacctataact |
200 |
Q |
| |
|
| |||||||||||||||| | |||||||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5355650 |
tcaaaaccgagagtgatttcgatcatgacaatttttttgtcattctggttttctgtttatgtgaatatgattcgaatcacatgtgcttttacctataact |
5355551 |
T |
 |
| Q |
201 |
agttgttttatgataataacatttgtggcaactcacaaaattgaaccttagatagatgcaacatgaaaaaactagggtttt |
281 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5355550 |
agtggttttatcataataacatttgtggcaactcacaaaattgaaccttagatagatgcaacatgaaaaaactaggatttt |
5355470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University