View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_68 (Length: 275)
Name: NF17168_low_68
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_68 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 17496685 - 17496522
Alignment:
| Q |
17 |
caaaattacctaaaga-tcaattttattaaaaattagttaaatatgaaaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttgann |
115 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17496685 |
caaaattacctaaaaaatcaattttattaaaaattagttaaatatgaaaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttggtt |
17496586 |
T |
 |
| Q |
116 |
nnnnngttggcttgaagctaaattttggaattttgtcatttaatttgcatgttaggtggataca |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17496585 |
tttttgttggcttgaagctaaattttggaattttgtcatttaatttgcatgttaggttgataca |
17496522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University