View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17168_low_68 (Length: 275)

Name: NF17168_low_68
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17168_low_68
NF17168_low_68
[»] chr6 (1 HSPs)
chr6 (17-179)||(17496522-17496685)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 17496685 - 17496522
Alignment:
17 caaaattacctaaaga-tcaattttattaaaaattagttaaatatgaaaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttgann 115  Q
    |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       
17496685 caaaattacctaaaaaatcaattttattaaaaattagttaaatatgaaaatggaagtgaaaacatgggagtgatgaacatgcatcgaagaagtgttggtt 17496586  T
116 nnnnngttggcttgaagctaaattttggaattttgtcatttaatttgcatgttaggtggataca 179  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
17496585 tttttgttggcttgaagctaaattttggaattttgtcatttaatttgcatgttaggttgataca 17496522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University