View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17168_low_69 (Length: 268)

Name: NF17168_low_69
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17168_low_69
NF17168_low_69
[»] chr7 (1 HSPs)
chr7 (18-250)||(26340655-26340887)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 26340655 - 26340887
Alignment:
18 gaaaagaaaaaattggaagtctcttcaagtcaaggaaacataatggtgtctccttatgacttgaacaactacgacaatccaggtaacataataacttaag 117  Q
    ||||||||  |||||||||||||||||||||||||||||| ||| |||||| |||| |||||||||||| | | ||||||||| ||||||||||||||||    
26340655 gaaaagaaggaattggaagtctcttcaagtcaaggaaacaaaatagtgtcttcttaagacttgaacaacaatggcaatccaggaaacataataacttaag 26340754  T
118 ttcaacttcgaggcgaaaactaggatgaatcggctcgtgccatgaaaaatttgttatgtgcgcagagaaaatggggattaatagaaggaagcatcccaaa 217  Q
    |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||    
26340755 ttcaacttcgagacgaaaactacgatgaatcggctcgtgccatgaaaaatttgttacgtgcgcagagagaatggggattaatagaaggaatcatcccaaa 26340854  T
218 acctgcagaaaactcacatgacatggaatattg 250  Q
    |||||||||||||||||||||||||||| ||||    
26340855 acctgcagaaaactcacatgacatggaagattg 26340887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University