View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_70 (Length: 268)
Name: NF17168_low_70
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 34752720 - 34752955
Alignment:
| Q |
1 |
accaactaactaactagattacaggtaaacatcatgtaa-----actaactatgaataactaacagaaaacttgtgatacaagtttcgaagaggtgaacc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34752720 |
accaactaactaactagattacaggtaaacatcatgtaagtataactaactatgaataactaacagaaaacttgtgatacaagtttcgaagaggtgaacc |
34752819 |
T |
 |
| Q |
96 |
gttgcatgctacgagacttgcttttcaatattcattctcactattatccatag-----atatattcaaccgacttgatacttcattcctcaccattacaa |
190 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34752820 |
gttgcatgctactagacttgcttttcaatattcattctcactattatccatagaccatatatattcaaccgacttgatacttcattcctcaccattacaa |
34752919 |
T |
 |
| Q |
191 |
accataatcaaattgtagaactctctagtttaggta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34752920 |
accataatcaaattgtagaactctctagtttaggta |
34752955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University