View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_71 (Length: 267)
Name: NF17168_low_71
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_71 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 10 - 133
Target Start/End: Complemental strand, 35211702 - 35211585
Alignment:
| Q |
10 |
attattcttcatgttcgttcttttgacaagactcttaatggttaataaatggttttcattccctaaaataaaagttttcattagatattcaaaaagataa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
35211702 |
attattcttcatgttcgttcttttgacaagactcttaatggttaataaatggttttcattccctaaaataaaagttttcattagacattcaa------aa |
35211609 |
T |
|
| Q |
110 |
ataaacgttgggtgtgtactagca |
133 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35211608 |
ataaacgttgggtgtgtactagca |
35211585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 204 - 265
Target Start/End: Complemental strand, 35211478 - 35211417
Alignment:
| Q |
204 |
tcaataacttactatttgttgaattcctaataagatatgtatttaggacctatggtagcatg |
265 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35211478 |
tcaataccttactatttgttgaattcctaataagatatgtatttaggacctatggtagcatg |
35211417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University