View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17168_low_78 (Length: 250)

Name: NF17168_low_78
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17168_low_78
NF17168_low_78
[»] chr8 (2 HSPs)
chr8 (122-239)||(5355970-5356091)
chr8 (20-67)||(5355899-5355946)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 5355970 - 5356091
Alignment:
122 aattgaatattagttataaacactccgtccggcaatatttcagaagttacgtgcatggttaataaattggcacgctttcctcgtgcagacaact----ca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    ||    
5355970 aattgaatattagttataaacactccgtccggcaatatttcagaagttacgtgcatggttaataaattggcacgctttcctcgtgcagacaactcacaca 5356069  T
218 cacaccaaacgttggccccttt 239  Q
    ||||||||||||||||||||||    
5356070 cacaccaaacgttggccccttt 5356091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 5355899 - 5355946
Alignment:
20 ataaattacaaaagttaaaagtacgatagcgaatagttaatttgtacc 67  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||    
5355899 ataaattacaaaagttaaaagtacgttagcgaatagttaatttgtacc 5355946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University