View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_80 (Length: 248)
Name: NF17168_low_80
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_80 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 11193889 - 11193658
Alignment:
| Q |
19 |
gattgactatcgcatgaatatgtaacatatgtgattggattggactactagcttcccgatgcacccactgccttcggcattccaattttgggggatcaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
11193889 |
gattgactatcgcatgaatatgtaacatgtgtgattggattggactactagcttcccgatgcacccactgccttaggcattccaattttgggggatcgca |
11193790 |
T |
 |
| Q |
119 |
tat-ggctatttgagtttcatgaacaacaagtaaatgtgtcttggtggtatcaaattgaaca-acacttgtagatctcatccctaagaccatgatatgta |
216 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11193789 |
tatgggctatttgagtttcataaacaacaagtaaatgtgtcttggtggtatcaaattgaacatacacttgtagatctcttccctaagaccatgatatgta |
11193690 |
T |
 |
| Q |
217 |
tgcttcatagctccttcactttcattccattc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11193689 |
tgcttcatagctccttcactttcattccattc |
11193658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 157 - 248
Target Start/End: Original strand, 47410341 - 47410431
Alignment:
| Q |
157 |
tcttggtggtatcaaattgaacaacacttgtagatctcatccctaagaccatgatatgtatgcttcatagctccttcactttcattccattc |
248 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
47410341 |
tcttggtggtatcaaattgaacaacacctgtagatctcttccc-aagaccatgatatgtgcgcttcacggctccttcactttcattccattc |
47410431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 94 - 159
Target Start/End: Original strand, 47407061 - 47407126
Alignment:
| Q |
94 |
ggcattccaattttgggggatcacatatggctatttgagtttcatgaacaacaagtaaatgtgtct |
159 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
47407061 |
ggcattccaattttggggcctcatatatggctatttgagtttcatgaacagcaagtaaatgtgtct |
47407126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 47406823 - 47406887
Alignment:
| Q |
19 |
gattgactatcgcatgaatatgtaacatatgtgattggattggactactagcttcccgatgcacccactg |
88 |
Q |
| |
|
||||||||||| |||||||||||| ||| |||||||||| | ||||||||||||| |||||||||| |
|
|
| T |
47406823 |
gattgactatcacatgaatatgtagcatgtgtgattgga-----ccactagcttcccgaggcacccactg |
47406887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University