View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_85 (Length: 239)
Name: NF17168_low_85
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_85 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 6886917 - 6887052
Alignment:
| Q |
1 |
atcttcatgagtgttgctctaaaaaacttcatagaaaatcacctagaacctctaccaaaattttcatgtactctcaaccatttgaaccataaaagtttag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6886917 |
atcttcatgagtgttgctataaaaaacttcatagaaaatcacctagaacctctaccaaaattttcatgtactctcaaccatttggaccataaaagtttag |
6887016 |
T |
|
| Q |
101 |
tggttcaatttgtcttttattaccaccatgtcacta |
136 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6887017 |
tggttcaatttgtcttctattaccaccatgtcacta |
6887052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 150 - 225
Target Start/End: Original strand, 6887141 - 6887217
Alignment:
| Q |
150 |
tatacagtatcaaaccatatcttaaaa-aacaagaaaacttatgagtgatcatccaaataaacaaagatgtatacgt |
225 |
Q |
| |
|
|||| ||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887141 |
tatatagtatcaaatcatatcttaaaaaaacaagaaaacttatgagtgatcatccaaataaacaaagatgtatacgt |
6887217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University