View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_88 (Length: 237)
Name: NF17168_low_88
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 21398294 - 21398067
Alignment:
| Q |
1 |
agaaagatactaaaatttgatcccctttaaaaggaaaaggaaa------caaataaatatcacttctagttaccttggcatcctttggataagaccctcc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21398294 |
agaaagatactaaaatttgatcccctttaaaaggaaaaggaaaaggaaacaaataaatatcacttctagttaccttggcatcctttggataagaccctcc |
21398195 |
T |
 |
| Q |
95 |
ccaaaatggttgtatgcaatggttacttgcatctgcttgtcacgaacatatgagtcactgtggcccaatagcataacctgtataattttgaactcaatta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21398194 |
ccaaaatggttgtatgcaatggttacttgcatctgcttgtcacgaacatatgagtcactgtggcccaatagcataacctgtataattttgaactcaatta |
21398095 |
T |
 |
| Q |
195 |
gtaaaataagtattagaaagacaaaagt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21398094 |
gtaaaataagtattagaaagacaaaagt |
21398067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 64 - 135
Target Start/End: Complemental strand, 17910426 - 17910355
Alignment:
| Q |
64 |
ttaccttggcatcctttggataagaccctccccaaaatggttgtatgcaatggttacttgcatctgcttgtc |
135 |
Q |
| |
|
||||| |||||| || || ||||||||||| ||||||||||| || || ||||| ||||||||||||||||| |
|
|
| T |
17910426 |
ttaccgtggcattctctgaataagaccctctccaaaatggttataagctatggtcacttgcatctgcttgtc |
17910355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University