View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17168_low_90 (Length: 237)
Name: NF17168_low_90
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17168_low_90 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 44997809 - 44998020
Alignment:
| Q |
12 |
atgaaggatgatgagcttgatgacatgatgaacagcctttcccagatttttcgttgggatcttcttgttggagagcgttacggcatcaaagccgccatta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44997809 |
atgaaggatgatgagcttgatgacatgatgaacagcctttcccagatttttcgttgggatcttcttgttggagagcgttacggcatcaaagctgccatta |
44997908 |
T |
|
| Q |
112 |
gagctgaacggagacgccttgatgaagaggaaattaaacgccggggtcttctttccggcgataccaccaacgctctcgatgctctctctcaagaaggtgc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44997909 |
gagctgaacggagacgccttgatgaagaggaaattaaacgccggggtcttctttccggcgataccaccaacgctctcgatgctctctctcaagaaggtgc |
44998008 |
T |
|
| Q |
212 |
acagtcatttat |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44998009 |
acagtcatttat |
44998020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University