View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17168_low_96 (Length: 229)

Name: NF17168_low_96
Description: NF17168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17168_low_96
NF17168_low_96
[»] chr3 (3 HSPs)
chr3 (4-213)||(54102894-54103103)
chr3 (75-147)||(44171371-44171443)
chr3 (75-147)||(44191667-44191739)


Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 213
Target Start/End: Complemental strand, 54103103 - 54102894
Alignment:
4 gcgcagctcgttgtctgtttgcttttcattccgtaaaacttcctctcaatagtcttggtcaaaaataaatacaggttttgatggagtggagatacatgga 103  Q
    ||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54103103 gcgcaactcgttgtttgtttgcttttcattccgtaaaacttcctctcaatagtcttggtcaaaaataaatacaggttttgatggagtggagatacatgga 54103004  T
104 gctaatggatacttgcttgatcaattcctaaaggacaaagtgaacgatagagatgacgggtatggagggagcttagaaaatcgttgtcgcttccctctag 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
54103003 gctaatggatacttgcttgatcaattcctaaaggacaaagtgaacgatagagatgacgagtatggagggagcttagaaaatcgttgtcgcttccctctag 54102904  T
204 aggttgtgaa 213  Q
    ||||||||||    
54102903 aggttgtgaa 54102894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 147
Target Start/End: Complemental strand, 44171443 - 44171371
Alignment:
75 caggttttgatggagtggagatacatggagctaatggatacttgcttgatcaattcctaaaggacaaagtgaa 147  Q
    ||||||||||||| ||||| || ||||||||| |||| ||| | ||||| |||||| | ||||| ||||||||    
44171443 caggttttgatggtgtggaaattcatggagctcatggctacctacttgaacaattcatgaaggataaagtgaa 44171371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 147
Target Start/End: Complemental strand, 44191739 - 44191667
Alignment:
75 caggttttgatggagtggagatacatggagctaatggatacttgcttgatcaattcctaaaggacaaagtgaa 147  Q
    ||||||||||||| ||||| || ||||||||| |||| ||| | ||||| |||||| | ||||| ||||||||    
44191739 caggttttgatggtgtggaaattcatggagctcatggctacctacttgaacaattcatgaaggataaagtgaa 44191667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University