View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17169_high_16 (Length: 247)

Name: NF17169_high_16
Description: NF17169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17169_high_16
NF17169_high_16
[»] chr5 (1 HSPs)
chr5 (15-228)||(886747-886960)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 228
Target Start/End: Complemental strand, 886960 - 886747
Alignment:
15 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
886960 aatattggcaatcaatcggttaacctttggcgatgaaaataaataaattttccatgttgaaaacttctgattccaacattaacacatgaacctcttgtag 886861  T
115 gtaagagattcatatgaaattaagaacaattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatatagagatacaaata 214  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
886860 gtaagagattcatatgaaattaagaataattgatcctgattttgccacttgtaagctcctaattgaacgaaatgtgtttagctatatagaggtacaaata 886761  T
215 atcgttaccctgaa 228  Q
    ||||||||||||||    
886760 atcgttaccctgaa 886747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University