View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1716_low_6 (Length: 400)
Name: NF1716_low_6
Description: NF1716
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1716_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 310
Target Start/End: Complemental strand, 4521204 - 4520929
Alignment:
| Q |
30 |
ttgaggttttacttataatcttggtcgagccacatcggttttagctgagattttagggtcatgcatggcttcccctaatggcaagcaggtccgatcctaa |
129 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
4521204 |
ttgatgttttacttataatcttggtcgggccacatcggttttagctgaggttttagggtgatgcgtggcttcgcctaatggcgagcaggtccgatcctaa |
4521105 |
T |
|
| Q |
130 |
gacttgtggggtcttgggcggccgcccttcttgcccaggctcagaaccacacctcatcgcgagtactaatggcgtggactggagggtgaaggagttgatt |
229 |
Q |
| |
|
||||| ||||||||||||| || |||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4521104 |
gacttttggggtcttgggcagctgcccttcttgcccatgctcagaaccacacctcatcgcgggtactaatggc-----atggagggtgaaggagttgatt |
4521010 |
T |
|
| Q |
230 |
cgtcatctcactcaattgttgcttattcttgatgtagatatttgagggacaagattttctcattaattcattagtttttct |
310 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4521009 |
cgtcatctctctcaattgtagcttattcttgatgtagatattcgagggacaagattttctgattaattcattagtttttct |
4520929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University