View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717-Insertion-24 (Length: 115)
Name: NF1717-Insertion-24
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717-Insertion-24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 7 - 115
Target Start/End: Complemental strand, 47847296 - 47847188
Alignment:
| Q |
7 |
acctgctactaaaatttgtagtcgattgggttgatggacaaattacatacttggaggcccaagaaactgctgccgttgttaatttctgcatgcgtttgct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47847296 |
acctgctactaaaatttgtagtcgattgggttgatggacaaattacatacttggaggcccaagaaactgctgccgttgttaatttctgcatgcgtttgct |
47847197 |
T |
|
| Q |
107 |
tcatctgta |
115 |
Q |
| |
|
||| ||||| |
|
|
| T |
47847196 |
tcagctgta |
47847188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University