View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1717-Insertion-25 (Length: 206)
Name: NF1717-Insertion-25
Description: NF1717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1717-Insertion-25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 2355836 - 2355650
Alignment:
| Q |
10 |
aaaaaggacaagatggagtatatatttaggtggataaggtggaaaatgattgtgtcgctgaattgttgtgttggcattttggtctttcgataatgaacat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2355836 |
aaaaaggacaagatggagtatatatttaggtggataaggtggaaaatgattgtgtcgctgaattgttgtgttggcattttggtcttttgataatgaacat |
2355737 |
T |
 |
| Q |
110 |
ttgcatcaataagggtttgcattcatttgatattcggttgtgtgattgatttagaacttgcttaatgatgttattttctccaacaaa |
196 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355736 |
ttgcatcaataagggttcacattcatttgatattcggttgtgtgattgatttagaacttgcttaatgatgttattttctccaacaaa |
2355650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University