View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17170_low_6 (Length: 224)
Name: NF17170_low_6
Description: NF17170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17170_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 1785323 - 1785117
Alignment:
| Q |
1 |
caaatcacaaagagacaccacatctattgatnnnnnnn-ccactattatgagacaccacaacttcaccaaaaatcttaaggtattaattaagtatacgag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1785323 |
caaatcacaaagagacaccacatctattgataaaaaaaaccactattatgagacaccacagcttcaccaaaaatcttaaggtattaattaaatatacgag |
1785224 |
T |
 |
| Q |
100 |
tcatttctcctaatttttagtcgatctgagacgaatcactcacacttaaattctaactatttccaccgccgttacaaaccaacggaaacaaaacatatca |
199 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1785223 |
tcatttctcctaattttttgtcgatctaggacgaattactcacacttaaattccaactatttgcaccgccgttacaaaccaacggaaacaaaacatgtca |
1785124 |
T |
 |
| Q |
200 |
cctgact |
206 |
Q |
| |
|
||||||| |
|
|
| T |
1785123 |
cctgact |
1785117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University