View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17170_low_9 (Length: 208)
Name: NF17170_low_9
Description: NF17170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17170_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 43144750 - 43144577
Alignment:
| Q |
17 |
atatacacaagaaaagaaatctaataagcagcagatttacacaggataattggttcnnnnnnngcagccaaaagaataaacaaaaatatttattgaagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
43144750 |
atatacacaagaaaagaaatctaataagcagcagatttacacaggataattggttcaaaaaaagcagccaaaagaataaacaaaaaaaattattgaagaa |
43144651 |
T |
|
| Q |
117 |
caatacacagaaatggaagaaatttctaatttgaatggagtttttaactctagaaaacactgttaactaaaatg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43144650 |
caatacacagaaatggaagaaatttctaatttgaatggagtttttaactctagaaaacactgttaactaaaatg |
43144577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 138 - 175
Target Start/End: Complemental strand, 42432804 - 42432767
Alignment:
| Q |
138 |
atttctaatttgaatggagtttttaactctagaaaaca |
175 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
42432804 |
atttataatttgaatggggtttttaactctagaaaaca |
42432767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University