View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17171_high_3 (Length: 298)
Name: NF17171_high_3
Description: NF17171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17171_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 35393537 - 35393274
Alignment:
| Q |
1 |
ttaattatgtgagtttctgtttaccattcgtacaaa--tagtatgtgtgaattgcaacagcacctaactatacgtgtttaattcagaatgatatgctcat |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393537 |
ttaattatgtgagtttctgtttgccattcgtacaaaaatagtatgtgtgaattgcaacagcacctaactatacgtgtttaattcagaatgatatgctcat |
35393438 |
T |
|
| Q |
99 |
aaatttgtgaaagttcaatatatatatctaaacataccaaccaccacacatatatatacattaacggagaagcgaagttaaccgtgaggcattggcagct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393437 |
caatttgtgaaagttcaatatatatatctaaacataccaaccaccacacatatatatacattaacggagaagcgaagttaaccgtgaggcattggcagct |
35393338 |
T |
|
| Q |
199 |
accaacttggcctcatgccttccataagaagcttgtcaatgctgttttggattataattaacaa |
262 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35393337 |
accaacttggcctcatgccttcgataagaagcttgtcaatgctgttttggattataattaacaa |
35393274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University